Interact CardioVasc Thorac Surg 2009;9:943-946. doi:10.1510/icvts.2009.211490 © 2009 European Association of Cardio-Thoracic Surgery
Work in progress report - Experimental |
Effect of 5-azacytidine induction duration on differentiation of human first-trimester fetal mesenchymal stem cells towards cardiomyocyte-like cells
Yihua Zhang,
Yuankui Chu,
Wenzheng Shen and
Zhongying Dou*
Shaanxi Branch of National Stem Cell Engineering and Technology Centre, College of Veterinary Medicine, Northwest A & F University, Yangling 712100, Shaanxi, China
Received 13 May 2009;
received in revised form 9 September 2009;
accepted 11 September 2009
This research was supported by grants from the Key Program of National Ministry of Education (03160), the National Natural Science Foundation of China (30671067) and the Key Program of Shaanxi Province (2006Kz05-G1).
*Corresponding author. Tel./fax: +86-029-8708-0068.
E-mail address: douzhongying{at}china.com (Z. Dou).
 |
Abstract
|
|---|
The aim of this study is to investigate effects of 5-azacytidine (5-aza) induction duration on differentiation of bone marrow mesenchymal stem cells (MSCs) from human first-trimester abortus (hfMSCs) towards cardiomyocyte-like cells. hfMSCs were stimulated with 10 µmol/l 5-aza for 24 h (group A), 48 h (group B) and 21 days (group C), respectively. During the induction, 30–40% of the cells gradually enlarged, elongated, connected with adjoining cells and formed myotube-like structures, branches and string-bead-like nuclei. Some of the cells congregated into cell clusters or strips. After the induction, numerous myofilaments in the cytoplasm and conjunction of intercalated disc-like structure between adjoining cells were observed. The induced cells expressed messenger ribonucleic acids (mRNAs) and proteins of myocardium-specific -actin, sarcomeric β-myocin heavy chain and troponin-T. The positive cell percentages for the three antigens in group C were each significantly higher than those antigens in group A and B (P<0.01) and the cell population doubling time (PDT) of group C was longer than those of group A and B (P<0.01). These indicate that 21-d induction with 10 µmol/l 5-aza slows down proliferation speed of hfMSCs but increases differentiation rate of hfMSCs into cardiomyocyte-like cells if compared with 24–48 h induction.
Key Words: Mesenchymal stem cells; Cardiomyocytes; 5-azacytidine; Human first-trimester abortus
 |
1. Introduction
|
|---|
Previous researches show that bone marrow cell transplantation at the time of acute myocardial infarction can improve cardiac function [1, 2]. Further researches substantiate that (1) hematopoietic stem cells improve cardiac function in the section of myocardial infarction through inducing neoangiogenesis [3], not through regenerating cardiomyocytes [4], (2) the beneficial effects of mesenchymal stem cells (MSCs) directly injected into the infarcted myocardium most likely result from the trophic effects of MSC-released substances on native cardiac and vascular cells, not from trans-differentiation into cardiomyocytes [5], and there is the risk for unwanted differentiation toward calcifications and/or ossifications after direct transplantation [6, 7], and (3) MSCs undergoing directed induction in vitro can improve cardiac function through regenerating cardiomyocytes after injections into the infarcted myocardium [8, 9]. Consequently, the search for novel strategies of inducing the cells toward a cardiac lineage in vitro has been recommended [10]. 5-azacytidine (5-aza) is a DNA demethylating chemical compound and previous studies have proved that 5-aza induces uncontrolled myogenic specification by random demethylation [11] and the optimal concentration of 5-aza to induce cardiomyogenic differentiation is 10 µmol/l [1]. However, almost in all reports relative to differentiation of MSCs induced with 5-aza into cardiomyocyte-like cells in vitro, the induction time of 5-aza is 24 h and no paper to focus on selecting the induction time of 5-aza was seen. This study was conducted to investigate the effects of 5-aza induction duration on proliferation and differentiation of bone marrow MSCs from human first-trimester abortus (hfMSCs) towards cardiomyocyte-like cells.
 |
2. Material and methods
|
|---|
2.1. Preparation of hfMSCs
Human first trimester abortuses (age of 10–12 weeks) were obtained from a local hospital with permission from the patients, hospital and the Ethics Committee of Northwest A & F University. hfMSCs were isolated from the aborted fetuses by scissoring their long bones lengthwise, followed by rinsing and culturing of the whole marrow cells in Minimum Essential Medium alpha ( -MEM, Gibco, Billings, Montana, USA), containing 20% fetal calf serum (FCS, Stemcell Technologies Inc, Vancouver, Canada), 100 IU/ml penicillin, 100 µg/ml streptomycin and 0.1 mmol/l β-mercaptoethanol (Sigma, Loveland, CO, USA). At 80% confluence of the cultured hfMSCs were harvested with 2.5 g/l trypsin (Gibco) containing 0.4 g/l edetic acid (Invitrogen, Carlsbad, California, USA) and passaged in a ratio of 1:3, with the medium changes every other day. Before differentiation the cells of passage 3 were detected by flow cytometer (Beckman Coulter Inc, Fullerton, California, USA) for antigen markers of the putative hfMSCs, CD29, CD44, CD71, CD105 and CD166, and those of hemopoietic stem cells, CD11a, CD14, CD34 and CD45 (all from Beckman Coulter Inc) as described previously [12].
2.2. Differentiation of cardiomyocyte-like cells
hfMSCs of the fourth passage were cultured in 12-well plates at 40–50% confluence and induced in three groups. The cells in group A and B were cultured respectively for 24 h and 48 h in a complete medium (RPMI1640, Gibco; 10% FCS, Stemcell; 100 IU/ml Penicillin and 100 µg/ml Streptomycin) plus 10 µmol/l 5-aza (Sigma-Aldrich Co, St Louis, USA), and then both switched to the complete medium without 5-aza. Those in group C were always cultured in the complete medium plus 10 µmol/l 5-aza. And cells cultured in the complete medium were used as uninduced stem cell control. All treatments were terminated at day 21 of total culture, with the medium changes every three days.
2.3. Transmission electron microscopy
The induced and uninduced cells were scraped and centrifugalized to cell clusters. The cell pellets were pre-fixed 4% glutaraldehyde in phosphate buffer solution (PBS) for 2 h, washed in PBS, post-fixed in 2% osmium tetroxide, dehydrated, stained in uranyl acetate, embedded in epoxy resin and made into ultrathin sections (60 nm). And the ultrastructure of cells in all groups was viewed and analysed under a LIBRA 200FE transmission electron microscope (SII NanoTechnology Inc, Japan).
2.4. Cell population doubling time (PDT)
To evaluate cell growth rate before, during and after the induction, cells were randomly collected and counted from five wells in every group. The PDT of the cells was calculated according to the formula PDT=(T–T0) lg2/(lgNt–lgN0). In this formula, PDT represents population doubling time, T0 and T separately represent starting time and ending time of cell culture, and N0 and Nt separately represent the cell number at the start and the end of each culture.
2.5. Immunocytochemical analysis
Induced and uninduced cells were fixed with paraformaldehyde in PBS for 10 min at room temperature. Non-specific binding was avoided by three washings with PBS. Then the cells were immunocytochemically stained with primary antibody against human myocardium-specific -actin, sarcomeric β-myocin heavy chain and troponin-T (Sigma), and HistostainTM-Plus kit (Beijing Zhongshan Biotechnology Inc, Beijing, China) according to the manufacturer's instructions. Finally, DAB substrates for peroxidase were used to visualize the antibody binding. Images were captured with an inverted microscope (Leica, Wetzlar, Germany). Immunocytochemical analysis was made for calculating positive cell ratio of myocardium-specific -actin, sarcomeric β-myocin heavy chain and troponin-T in induced cells by taking count of the cells from any five visual fields under a microscope (x200).
2.6. Total ribonucleic acid (RNA) isolation and reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was extracted with Trizol Reagent (Invitrogen) from induced and uninduced hfMSCs. Transcriptional expression of myocardium-specific -actin, sarcomeric β-myocin heavy chain and troponin-T genes was determined by semi-quantitative RT-PCR using the RevertAidTM First Strand cDNA Synthesis Kit (Fermentas, Hanover, MD, USA) and Ex Taq® (TaKaRa, Shiga, Japan) according to the manufacturer's instructions. Transcript levels were standardized to the corresponding human β-actin level. The forward and reverse primers for each PCR set were designed to be located by the primer premier 5.0 [ -actin: For: ATCTATGAGGGCTACGC, Rev: GCAGTGGTGACAAAGGA (119 bp), β-myocin: For: AGGAGCAAGCCAACA, Rev: TTCAAGCCCTTCGTG (142 bp), troponin-T: For: AGAGGTGGTGGAAGAGTA, Rev: CTGGGCTTTGGTTTG (189 bp), human β-actin: For: AGTTGCGTTACACCCTTTCTTG, Rev: TCACCTTCACCGTTCCAG TTT (150)]. The thermal profile for PCR was 95 °C for 5 min, followed by 30 cycles of 30 s at 95 °C, with 1-min annealing intervals (52 °C for -actin, β-myocin, troponin-T and β-actin) followed by 1 min extension at 72 °C. An additional 10-min incubation at 72 °C was included after completion of the last cycle. Following the PCR, 5 µl of the PCR product was electrophoresed on a 1% agarose gel and imaged using a gel imaging instrument (Syngene, Cambridge, UK).
 |
3. Results
|
|---|
The whole marrow cell culture resulted in spindle cells adhered on the 4th day. Many clonally growing spindle cells were observed on the 8th day and spread at the bottom of culture dishes on the twelfth day with vortex distribution (Fig. 1). Cytometric analysis showed that the isolated cells of passage 3 strongly expressed the surface markers of MSCs, such as CD44 (91.1%), CD29 (94.5%), CD71 (53.5%), CD166 (93.9%) and CD105 (92.8%), but were almost negative for those of hemopoietic stem cells, CD11a (1.7%), CD14 (0.2%), CD34 (0.6%) and CD45 (0.2%), indicating that the cells of passage 3 belong to MSCs.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 1. Adhered spindle cells (a) were derived from the whole bone marrow cells at day 4 of culture. Primary cells (b) grew from clonally proliferating spindle cells at day 8 of culture and adhered primary cells propagated into whirlpool-like confluency (c).
|
|
During exposure to 5-aza, some cells died and detached whereas the surviving cells adhered and began proliferating and differentiating. One week later, approximately 30–40% of the adherent cells in all three experimental groups had enlarged, elongated and formed stick-like morphologies (Fig. 2a, b). Within 2–3 weeks, the cells connected with adjoining cells and formed myotube-like structures, branches (Fig. 2c, d) and string-bead-like nuclei (Fig. 2e). Some of the cells congregated into a cell cluster or cell strip (Fig. 2f, g), but beat was not found. Under transmission electron microscopy, numerous myofilaments in the cytoplasm aligned in a parallel fashion were observed in all experimental groups but without forming typical striated sarcomeres (Fig. 2h, i), and conjunction of intercalated disc-like structure between adjoining cells was seen (Fig. 2j–l). There were no such histological changes in control cells. Immunocytochemical analysis revealed that many of induced cells in all experimental groups were strongly positive for human myocardium-specific -actin, sarcomeric β-myocin heavy chain and troponin-T (Fig. 3), but cells in control group were negative for the three antigens. Semi-quantitative RT-PCR analysis showed that the induced cells in all experimental groups expressed the genes of human myocardium-specific -cardiac actin, cardiac β-myocin heavy chain and troponin-T, but cells in control group did not express these genes (Fig. 4).

View larger version (216K):
[in this window]
[in a new window]
|
Fig. 2. During exposure to 5-aza, some cells enlarged, elongated and formed stick-like morphologies (a and b), then connected with adjoining cells and formed myotube-like structures, branches (c and d) and string-bead-like nuclei (e). Some of the cells congregated into cell clusters or cell strips (f and g). Under transmission electron microscopy, numerous myofilaments in the cytoplasm were observed (h, magnification: 25,000x; i, magnification: 50,000x), and conjunction of intercalated disc-like structure between adjoining cells was seen (j and k, magnification: 30,000x; l, magnification: 50,000x).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4. RT-PCR analysis of expression of specific cardiomyogenic markers. Cells induced by 5-aza for 24 h (Line 2), 48 h (Line 3) and 21 days (Line 4) expressed β-actin (150 bp), -actin (119 bp), β-myocin (142 bp) and troponin-T (189 bp), Line 1: uninduced hfMSCs as a negative control, Line 5: human fetal cardiac muscle as a positive control.
|
|
After induction cell PDTs of three experimental groups (A: 6.62±0.406 days, B: 6.86±0.455 days, C: 9.09±1.195 days) were significantly longer than that of the control group (2.55±1.075) (P<0.01). The PDT of group C was significantly longer than those of group A and B (P<0.01), without statistic difference between those of group A and B. Immunocytochemical analysis showed that the positive cell percentages for myocardium-specific -actin, sarcomeric β-myocin heavy chain and troponin-T were respectively at 38.28±2.198%, 37.16±2.518% and 37.98±1.931% in group A, 37.00±3.317%, 37.44±1.954% and 38.01±2.278% in group B, and 44.54±2.337%, 46.94±5.128% and 45.26±2.698% in group C. The positive cell percentages of group C were each significantly higher than those of all three antigens in group A and B (P<0.01). However, there was no statistic difference in each of the positive cell percentages of the all antigens between group A and B.
 |
4. Discussion
|
|---|
Previous reports show that, after treatment with 5-aza, the differentiation rates of adult human marrow MSCs, immortalized mouse marrow MSCs and immortalized porcine marrow MSCs into cardiomyocyte-like cells are 20–30% [13], 30% [14] and 30–50% [15], respectively. In this study, the differentiation rates of 5-aza-treated bone marrow MSCs from hfMSCs in three experimental groups are 37–38%, 37–38% and 44–47%, respectively, which are higher than that of adult human marrow MSCs and immortalized mouse marrow MSCs, and similar to those of immortalized porcine marrow MSCs, implying that the differentiation potential of hfMSCs into cardiomyocyte-like cells is stronger than that of adult human marrow MSCs.
The optimal concentration of demethylating agent 5-aza to induce cardiomyogenic differentiation is 10 µmol/l [1]. In this study, hfMSCs were induced with RPIM1640 complete medium plus 10 µmol/l 5-aza, of which, group A and group B were respectively switched to RPIM1640 complete medium without 5-aza after 24 h and 48 h, and group C was always cultured in RPIM1640 complete medium plus 10 µmol/l 5-aza. The cell PDT of group C (9.09±1.195 days) was significantly longer than those of group A (6.62±0.406 days) and B (6.86±0.455 days) (P<0.01), indicating that longer the time of 5-aza treatment slows down the cell proliferation speed. Immunocytochemical analysis showed that the positive cell percentage of group C (44–47%) was significantly higher than those of group A (37–38%) and B (37–38%) (P<0.01), indicating that longer time of 5-aza treatment can increase the differentiation rate of cells into cardiomyocyte-like cells.
Our previous research has proved that hfMSCs derived from human first trimester abortus perform partial characteristics of embryonic stem cells, quicker growth speed and no tumor formation in the investigated animal [12]. The research results indicate that hfMSCs can be directedly induced into a cardiomyogenic phenotype with 5-aza in vitro, with excellent differentiation outcome, such as a number of myotube-like and branch structure, string-bead-like nuclei, myofilaments, conjunction of intercalated disc-like structure and higher differentiation rate, long-time induction with 5-aza is an effective means for directed differentiation of hfMSCs into cardiomyogenic lineage in vitro, can provide seed cells for cardiomyogenic transplantation studies and was used prior to transplantation studies to ensure that the differentiation process will be directed towards the cardiomyogenic lineage in the in vivo environment.
We are not advocating carrying out abortions for the single purpose of obtaining fetal MSCs, but in some countries with family planning policy, one-child policy or birth-control policy, a human abortus, first-trimester abortus in particular, can be used as a source of obtaining a variety of fetal stem cells. Certainly, such an approach may be suitable for certain societies, but may be controversial in some others.
 |
References
|
|---|
- Tomita S, Li R-K, Weisel RD, Mickle DAG, Kim E-J, Sakai T, Jia Z-Q. Autologous transplantation of bone marrow cells improves damaged heart function. Circulation 1999;100:II-247–II-256.
- Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal-Ginard B, Bodine DM, Leri A, Anversa P. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701–705.[CrossRef][Medline]
- Balsam LB, Wagers AJ, Christensen JL, Kofidis T, Weissman IL, Robbins RC. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 2004;428:668–673.[CrossRef][Medline]
- Murry CE, Soonpaa MH, Reinecke H, Nakajima H, Nakajima HO, Rubart M, Pasumarthi KB, Virag JI, Bartelmez SH, Poppa V, Bradford G, Dowell JD, Williams DA, Field LJ. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 2004;428:664–668.[CrossRef][Medline]
- Zhang M, Mal N, Kiedrowski M, Chacko M, Askari AT, Popovic ZB, Koc ON, Penn MS. SDF-1 expression by mesenchymal stem cells results in trophic support of cardiac myocytes after myocardial infarction. FASEB J 2007;21:3197–3207.[Abstract/Free Full Text]
- Yoon Y-S, Park J-S, Tkebuchava T, Luedeman C, Losordo DW. Unexpected severe calcification after transplantation of bone marrow cells in acute myocardial infarction. Circulation 2004;109:3154–3157.[Abstract/Free Full Text]
- Breitbach M, Bostani T, Roell W, Xia Y, Dewald O, Nygren JM, Fries JWU, Tiemann K, Bohlen H, Hescheler J, Welz A, Bloch W, Jacobsen SEW, Fleischmann BK. Potential risks of bone marrow cell transplantation into infarcted hearts. Blood 2007;110:1362–1369.[Abstract/Free Full Text]
- Bartunek J, Croissant JD, Wijns W, Gofflot S, de Lavareille A, Vanderheyden M, Kaluzhny Y, Mazouz N, Willemsen P, Penicka M, Mathieu M, Homsy C, De Bruyne B, McEntee K, Lee IW, Heyndrickx GR. Pretreatment of adult bone marrow mesenchymal stem cells with cardiomyogenic growth factors and repair of the chronically infarcted myocardium. Am J Physiol Heart Circ Physiol 2007;292:H1095–H1104.[Abstract/Free Full Text]
- Hahn J-Y, Cho H-J, Kang H-J, Kim T-S, Kim M-H, Chung J-H, Bae J-W, Oh B-H, Park Y-B, Kim H-S. Pre-treatment of mesenchymal stem cells with a combination of growth factors enhances gap junction formation, cytoprotective effect on cardiomyocytes, and therapeutic efficacy for myocardial infarction. J Am Coll Cardiol 2008;51:933–943.[Abstract/Free Full Text]
- Chien KR. Stem cells: lost in translation. Nature 2004;428:607–608.[CrossRef][Medline]
- Tomita S, Mickle DAG, Weisel RD, Jia Z-Q, Tumiati LC, Allidina Y, Liu P, Li R-K. Improved heart function with myogenesis and angiogenesis after autologous porcine bone marrow stromal cell transplantation. J Thorac Cardiovasc Surg 2002;123:1132–1140.[Abstract/Free Full Text]
- Yihua Z, Zhongying D, Wenzheng S, Chunrong Y, Zhimin G. Isolation and culture of bone marrow mesenchymal stem cells fro human fetus and its biological properties. J Agr Biotechn 2008;16:443–449.
- Antonitsis P, Ioannidou-Papagiannaki E, Kaidoglou A, Papakonstantinou C. In vitro cardiomyogenic differentiation of adult human bone marrow mesenchymal stem cells. The role of 5-azacytidine. Interact CardioVasc Thorac Surg 2007 Oct;6:593–597.[Abstract/Free Full Text]
- Makino S, Fukuda K, Miyoshi S, Konishi F, Kodama H, Pan J, Sano M, Takahashi T, Hori S, Abe H, Hata J, Umezawa A, Ogawa S. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest 1999;103:697–705.[Medline]
- Moscoso I, Centeno A, Lopez E, Rodriguez-Barbosa JI, Santamarina I, Filgueira P, Sanchez MJ, Dominguez-Perles R, Penuelas-Rivas G, Domenech N. Differentiation "in vitro" of primary and immortalized porcine mesenchymal stem cells into cardiomyocytes for cell transplantation. Transplant Proc 2005;37:481–482.[CrossRef][Medline]
|
|