ICVTS Click here to goto Smart Canula website
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Interact CardioVasc Thorac Surg 2007;6:593-597. doi:10.1510/icvts.2007.157875
© 2007 European Association of Cardio-Thoracic Surgery

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antonitsis, P.
Right arrow Articles by Papakonstantinou, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antonitsis, P.
Right arrow Articles by Papakonstantinou, C.
Related Collections
Right arrow Cardiac - other
Right arrow Molecular biology

Work in progress report - Experimental

In vitro cardiomyogenic differentiation of adult human bone marrow mesenchymal stem cells. The role of 5-azacytidine{star}

Polychronis Antonitsisa,*, Elisavet Ioannidou-Papagiannakib, Aikaterini Kaidoglouc and Christos Papakonstantinoua

a First Department of Thoracic and Cardiovascular Surgery, Aristotle University of Thessaloniki, AHEPA Hospital, Thessaloniki, Greece
b Department of Hematology, Second Department of Internal Medicine, Aristotle University of Thessaloniki, Ippokrateio General Hospital, Thessaloniki, Greece
c Department of Histology-Embryology, Medical School, Aristotle University of Thessaloniki, Greece

Received 16 April 2007; received in revised form 29 June 2007; accepted 2 July 2007

{star} Presented at the 56th International Congress of the European Society for Cardiovascular Surgery, Venice, Italy, May 17–20, 2007.

*Corresponding author. Sakellaridi 25, 542 48 Thessaloniki, Greece, Tel.: +30 2310329729.

E-mail address: antonits{at}otenet.gr (P. Antonitsis)


    Abstract
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
The aim of this study is to investigate the ability of adult human bone marrow mesenchymal stem cells to differentiate towards a cardiomyogenic phenotype in vitro. Bone marrow samples have been aspirated from 30 patients undergoing open heart surgery. Mesenchymal stem cells were isolated and cultured in enriched medium. Second passaged cells were treated with 10 µM 5-azacytidine for 24 h. Selected surface antigens were analyzed by flow cytometry. Morphologic characteristics were analyzed by confocal and electron microscopy. Expression of cytoskeletal protein vimentin and muscle specific myocin heavy chain were analyzed by immunohistochemistry. Expression of {alpha}-cardiac actin, beta-myocin heavy chain and cardiac troponin-T was detected by reverse transcriptase polymerase chain reaction. Mesenchymal stem cells were spindle-shaped with irregular processes. Cells treated with 5-azacytidine have assumed a stick-like morphology. They were connecting with adjoining cells forming myotube-like structures. Numerous myofilaments were detected in induced cells running in a parallel fashion without forming sarcomeres that were immunohistochemically positive for myosin heavy chain and vimentin. The mRNAs of {alpha}-cardiac actin, beta-myosin heavy chain and troponin-T were expressed in both induced and uninduced cells. These results indicate that adult human bone marrow mesenchymal stem cells can differentiate towards a cardiomyogenic lineage in vitro.

Key Words: Mesenchymal stem cells; Cardiomyocytes; 5-azacytidine


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
Cellular cardiomyoplasty has been introduced as a potential therapy for treating heart failure and has generated significant interest in identifying various cell types capable of restoring the injured myocardium [1]. Autologous human bone marrow-derived mesenchymal stem cells (hMSCs) retain the ability to differentiate into various types of tissue cells in vitro and in vivo and contribute to the regeneration of bone, cartilage, muscle and adipose tissue [2]. Transplanted hMSCs have been shown to engraft at high numbers in infarcted heart and lead to functional benefit by increasing neovascularization and improving regional contractility and global diastolic function [3]. Considering the potential of hMSCs to differentiate into multiple lineages, it is likely that only a small fraction of transplanted cells would differentiate into cardiomyocytes. There is a strong likelihood that both the engraftment efficiency of the transplanted stem cells, as well as the clinical efficacy of treatment may be improved, if multipotent undifferentiated cells were directed to some degree towards the cardiomyogenic lineage in vitro prior to transplantation.

The earliest in vitro demonstration that bone marrow MSCs can differentiate into beating cells with cardiac phenotype was described by Makino in 1999 by treating immortalized murine MSCs with 5-azacytidine (5-aza) [4]. A closely regulated in vitro environment may be necessary for the occurrence of the transdifferentiation process that would utilize chemically defined culture media supplemented with recombinant cytokines and growth factors [5]. This study was conducted to investigate the ability of hMSCs to differentiate in vitro into cardiomyocytes after treatment with 5-aza.


    2. Material and methods
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
Thirty patients scheduled for coronary artery bypass grafting (CABG) were recruited into the study after informed consent. There were 22 male and 8 female patients with a mean age of 54.8±13.4 years. The study received Institutional Review Board approval. Bone marrow was aspirated from the anterior iliac crest after induction to anesthesia. The marrow was processed immediately to remove mature blood cell lineages using antibodies against CD3, CD14, CD19, CD38, CD66b, and Glycophorin-A markers (StemCell Technologies, Vancouver, Canada). The preparation was then centrifuged in a 1.077 g/ml Histopaque (Sigma, St. Louis, MO) density gradient and the enriched cells were collected from interphase, resuspended in culture medium, and transferred into T-25 tissue culture flasks at a density of 4–6x105/cm2.

2.1. Culture and differentiation of cardiomyocyte-like cells

The cells were expanded in MesenCult growth medium (Basal Medium for Human Mesenchymal Stem Cells, StemCell Technologies) enriched with mesenchymal stem cell stimulatory supplements (StemCell Technologies), which contain L-glutamine, penicillin (100 U/ml) streptomycin (100 µg/ml) and amphotericin B (1 µg/ml) at 37 °C at humid 5% CO2 atmosphere. After approximately seven days nonadherent cells were removed by replacing the medium. After that, fresh medium was changed every seven days. The subconfluent cells in the seed cultures were removed from the flasks by 0.25% trypsin/EDTA (StemCell Technologies) treatment 21–28 days after the initial plating at a ratio of one to three density for further culturing. Human MSCs of the second passage were resuspended after trypsin treatment in complete medium containing 10 µM 5-azacytidine (Sigma-Aldrich Co, St. Louis, USA) for induction of cardiomyogenic differentiation. After incubating for 24 h, the cells were washed twice with phosphate-buffered saline (PBS-Gibco BRL®, USA) and the medium was changed to complete medium without 5-azacytidine. The medium was changed every seven days and the experiment was terminated four weeks after the drug treatment.

2.2. Flow cytometric analysis

Untreated hMSCs at passage 2 were treated with 0.25% trypsin-EDTA, harvested, and washed twice with PBS. The cells were incubated on ice with labelled mouse anti-human antibodies for CD3, CD15, CD45 (FITC-conjugated), CD4, CD13, CD14, CD33, CD34, CD105 (SH2) (PE-conjugated). All antibodies were purchased from Immunotech Inc. Control groups were incubated with FITC- and PE-conjugated antibodies against mouse IgG1. The labeled cells were analyzed by flow cytometry on an EPICS-XL MCL (Beckman Coulter, FL, USA) analyzer.

2.3. Transmission electron microscopy

Ultrastructural analysis with transmission electron microscopy was performed on passage 2 induced and uninduced cells and also on adherent hMSCs after seven days in cultures that were used as negative controls. The initial fixation was done in PBS containing 3% glutaraldehyde for 2 h. The cell pellet was then washed in PBS and post-fixed in 2% osmium tetroxide, dehydrated and stained in uranyl acetate. Then the cells were embedded in epoxy resin. Ultrathin sections cut horizontally to the growing surface were viewed under a JEOL TCM 2 XII transmission electron microscope.

2.4. Immunohistochemistry analysis

Induced and uninduced cells were fixed with acetone in PBS for 5 min at room temperature. Non-specific binding was avoided by several washings with PBS. Then the cells were incubated for 2 h at 4 °C with primary antibody against sarcomeric beta-myosin heavy chain (Novocastra Laboratories Ltd, UK), and overnight at 4 °C with primary antibody against vimentin (Monoclonal Anti-Vimentin, Sigma-Aldrich Inc.). After washing with PBS, cells were incubated with biotinylated goat anti-mouse IgG (Abcam;1:200) as secondary antibody. Then horseradish peroxidase (HRP) conjugated with Avidin/Biotin Complex (Vectastain® ABC Kit, Vector Laboratories Inc, 1:200) was used as detection reagent and finally DAB substrates for peroxidase were used to visualize the antibody binding.

2.5. Total RNA isolation and RT-PCR

Total RNA was extracted with QIAMP® RNA Blood Mini Kit (QIAGEN Ltd.) from treated and untreated cells and from MSCs that were not expanded in culture. For RT-PCR cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen Life Technologies, CA, USA) for 10 min at 25 °C, 50 min at 42 °C and terminated at 95 °C for 5 min. The endogenous ‘house-keeping’ gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) was used to evaluate the efficiency of reverse transcription. PCR primers for cardiac-specific genes {alpha}-cardiac actin, cardiac beta-myosin heavy chain and troponin-T were designed by the researchers [{alpha}-cardiac actin: For:TCTATGAGGGCTACGCTTTG, Rev:GCCAA- TAGTGATGACTTGGC (260 bp), cardiac beta-myocin heavy chain: For:CGAGGCAAGCTCACCTACAC, Rev:CATTAACAG- CCTCCACGGCC (319 bp), cardiac troponin-T: For:AGAGC- GGAAAAGTGGGAAGA, Rev: CTGGTTATCGTTGATCCTGT (235 bp), GAPDH: For: GTCAACGGATTTGGTCGTATTG, Rev: CATGGGTGGAATCATATTGGAA (139 bp)]. The thermal profile for PCR was 94 °C for 5 min, followed by 35 cycles of 30 s at 94 °C, with 1 min annealing intervals (60 °C for {alpha}-cardiac actin, 63 °C for beta-myosin heavy chain and 58 °C for cardiac troponin-T) followed by 1 min extension at 72 °C. An additional 10 min incubation was included after completion of the last cycle. The PCR products were analyzed by electrophoresis with 2% agarose gel and photographed under UV light.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
After three days in primary culture MSCs adhered to the plastic surface, presenting a small population of single cells. The majority of cells displayed under phase microscopy a spindle-like fibroblastic shape with one nucleus. These cells began to proliferate at about day 7, and gradually grew to form small colonies (Fig. 1a). As growth of the cells continued, colonies gradually expanded in size with the adjacent ones interconnected to each other. The colonies reached confluency at 21–28 days after initial plating, depending on the proliferating ability of each sample (Fig. 1b).


Figure 1
View larger version (133K):
[in this window]
[in a new window]

 
Fig. 1. (a) hMSCs under phase microscopy cultured for seven days (magnificationx100), (b) spindle-shaped hMSCs became confluent after 21 days in culture, (c) cell with long cytoplasmic process one week after induction with 5-aza, (d) cell with multiple branches two weeks after induction, (e) cells connecting with adjoining cells forming myotube-like structures four weeks after induction (magnificationx200).

 
Passaged MSCs behaved similarly to those in primary cultures. There were two main types of cells: small spindle- or triangle-like and broad flattened cells. It seemed that the spindle- and triangle-like MSCs gradually were transformed into broad flattened cells. Cytometric analysis revealed that hMSCs were positive for CD13 and CD105 (SH2), which is considered as a marker for MSCs, and negative for hematopoietic lineage markers CD3, CD4, CD14, CD15, CD33, CD34 and CD45.

After induction with 5-aza some adherent cells died, whereas the surviving cells began to proliferate and differentiate. At one week the cells showed multinucleation and extended their cytoplasmic processes with adjacent cells. Approximately 20–30% of the cells aggregated and gradually increased in size to form a stick-like appearance (Fig. 1c). At three weeks the cells became enlarged and showed a number of branches (Fig. 1d). At four weeks they formed myotube-like structures by connecting with adjoining cells (Fig. 1e). Uninduced cells maintained their fibroblast-like morphology.

Ultrastructural analysis with transmission electron microscopy revealed that undifferentiated MSCs appeared similar with an irregularly shaped plasma membrane forming small pseudopodia all around the cell. The nucleus was pale and eccentric. The inner part of the cytoplasm was rich in round and elongated mitochondria with electron-dense matrices and thick cristae. The endoplasmic reticulum and the Golgi apparatus were dilated at some areas giving to the cytoplasm a vacuolated appearance (Fig. 2a). In untreated cells cytoplasmic filaments were observed, but were rare and their alignment was intricate (Fig. 2b). Induced cells four weeks after treatment with 5-azacytidine on longitudinal section showed numerous myofilaments in the cytoplasm aligned in a parallel fashion but without forming typical striated sarcomeres (Fig. 2c). Immunohistochemical analysis revealed that induced cells were strongly positive for beta-myosin heavy chain and vimentin whereas uninduced cells were negative for sarcomeric beta-myosin heavy chain but positive to vimentin (Fig. 3).


Figure 2
View larger version (81K):
[in this window]
[in a new window]

 
Fig. 2. Transmission electron micrographs of hMSCs. (a) undifferentiated hMSC with one nucleus and multiple pseudopodia (magnificationx11,500), (b) uninduced cell with rare cytoplasmic filaments (magnificationx42,0000), (c) longitudinal section of 5-aza induced hMSC towards a cardiomyogenic phenotype. Numerous myofilaments are detected in the cytoplasm aligned in a parallel fashion without forming visible sarcomeres (magnificationx55,000).

 

Figure 3
View larger version (66K):
[in this window]
[in a new window]

 
Fig. 3. Immunohistochemical staining of induced hMSCs for beta-myosin heavy chain and vimentin (magnificationx400).

 
RT-PCR analysis for the expression of cardiomyocyte-specific genes showed that both induced and uninduced cells expressed {alpha}-cardiac actin, cardiac beta-myosin heavy chain and cardiac troponin-T (Fig. 4). Cardiomyocyte-specific genes were not expressed in undifferentiated MSCs not being expanded in culture.


Figure 4
View larger version (66K):
[in this window]
[in a new window]

 
Fig. 4. RT-PCR analysis of expression of specific cardiomyogenic markers. 5-aza induced cells (Line 3) and uninduced cells (Line 4) express {alpha}-cardiac actin (260 bp), cardiac troponin-T (235 bp) and cardiac beta-myocin heavy chain (319 bp). Isolated MSCs not expanded in culture (Line 5) were negative for all three genes. [Line 1: marker, Line 2: GAPDH house-keeping gene (139 bp)].

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
The method reported here was modified from that described by Wakitani et al. for isolating MSCs from rat bone marrow [6]. The ideal culture milieu for promoting in vitro cardiomyogenic differentiation of stem cells should be chemically defined with the possible supplementation of specific recombinant cytokines and growth factors [7]. Shim et al. showed that hMSCs can be independently differentiated towards a cardiomyogenic lineage with defined myocardial characteristics using Dulbeccos's Modified Eagle's Medium (DMEM) supplemented with 10% FBS, insulin, transferring, sodium selenite, albumin, linoleic acid, ascorbate phosphate and dexamethasone [8].

Analysis by transmission electron microscopy revealed that hMSC population is relatively uniform in terms of ultrastructure. This observation might be particularly useful in detecting MSCs after injection into other tissues and for assessing morphological changes after transplantation. Among the various morphological features detected, the presence of many small pseudopodia around the entire periphery might help to explain the capacity of the cells for migration within the receiving tissue [9]. Ultrastructural features that can be used to distinguish MSCs from fibroblasts include the eccentric, irregularly shaped nucleus and the rich inner cytoplasmic zone in organelles, especially mitochondria and Golgi apparatus.

Passage 2 cells were treated with the demethylating agent 5-azacytidine to induce cardiomyogenic differentiation. Tomita et al. reported that the optimal concentration for cardiomyogenic differentiation is 10 µM for 24 h [10]. At four weeks after induction myotube-like structures were formed. The changes in morphology with the characteristic appearance of ‘stick-like’ cells may be associated with the expression of proteins maintaining cytoskeleton. Ultrastructural analysis by transmission electron microscopy revealed the presence of numerous myofilaments in the treated cell population. Immunohistochemical analysis showed expression of beta-myosin heavy chain, while the untreated population was only positive to the cytoskeletal protein vimentin. Fukuda et al. established a cardiomyogenic cell line from murine bone marrow stroma and found typical striation and sarcomeres formation eight weeks after treatment with 3 µM 5-aza [11]. Xu et al. found no sarcomeres formation in human MSCs two weeks after treatment with 10 µM 5-aza [12].

According to molecular analysis, treated and untreated cells both acquired the molecular phenotype of cardiomyogenic cell, although electron microscopy and immunohistochemistry showed significant differences in morphology and protein synthesis. Seshi et al. by using single-cell microarrays analysis showed that isolated single MSCs simultaneously express transcripts associated with osteoblast, fibroblast, muscle and adipocyte differentiation [13]. This study combined with the findings reported by the Verfaille's group supports the theory that MSCs are ‘pluridifferentiated’ cells at the molecular level [14].

The mechanism by which 5-aza promotes cardiomyogenic differentiation remains unclear. Ye et al. analyzed the effect of 5-aza on the protein expression of porcine bone marrow MSCs in vitro by using proteomics techniques [15]. They found up-regulation in the expression of proteins involved in cell proliferation and differentiation, including cardiac alpha tropomyocin. Our results indicate that MSCs derived from adult human bone marrow can be directed towards a cardiomyogenic phenotype in vitro. 5-aza can be used to induce ultrastructural changes. Pre-treatment of these multipotent cells can be used prior to transplantation studies to ensure that the differentiation process will be directed towards the cardiomyogenic lineage in the in vivo environment.


    Acknowledgements
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
We thank Mr. Athanassios Kalogeridis for his contribution to the molecular studies, Nicholas Charokopos who assisted in patients selection, Ioanna Kyriakopoulou in flow cytometry analysis, Kokkona Koliakou in immunohistochemistry analysis and Prof. Ioannis Klonizakis in designing the experimental protocol.


    References
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 

  1. Siepe M, Heilman C, von Samson P, Menasche P, Beyersdorf F. Stem cell research and cell transplantation for myocardial regeneration. Eur J Cardiothor Surg 2005; 28:318–324.[Abstract/Free Full Text]
  2. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human mesenchymal stem cells. Science 1999; 284:143–147.[Abstract/Free Full Text]
  3. Kocher AA, Schuster MD, Szabolcs MJ, Takuma S, Burkhoff D, Wang J, Homma S, Edwards NM, Itescu S. Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med 2001; 7:430–436.[CrossRef][Medline]
  4. Makino S, Fukuda K, Miyoshi S, Konishi F, Kodama H, Pan J, Sano M, Takahashi T, Hori S, Abe H, Hata J, Umezawa A, Ogawa S. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest 1999; 103:697–705.[Medline]
  5. Dimarakis I, Habib HA, Gordon M. Adult bone marrow-derived stem cells and the injured heart: just the beginning? Eur J Cardiothor Surg 2005; 28:665–676.[Abstract/Free Full Text]
  6. Wakitani S, Saito T, Caplan AI. Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle Nerve 1995; 18:1417–1426.[CrossRef][Medline]
  7. Goldsborough MD, Tilkins ML, Price PJ. Serum-free culture of murine embryonic stem (ES) cells. Focus 1998; 20:8–12.
  8. Shim WS, Jiang S, Wong P, Tan J, Chua YL, Tan YS, Sin YK, Lim CH, Chua T, The M, Liu TC, Sim E. Ex vivo differentiation of human adult bone marrow stem cells into cardiomyocyte-like cells. Bioch Biophys Res Commun 2004; 324:481–488.[CrossRef][Medline]
  9. Raimondo S, Penna C, Pagliaro P, Geuna S. Morphological characterization of GFP stably transfected adult mesenchymal bone marrow stem cells. J Anat 2006; 208:3–12.[CrossRef][Medline]
  10. Tomita S, Li RK, Weisel R, Mickle DA, Kim EJ, Sakai T, Jia ZQ. Autologous transplantation of bone marrow cells improves damaged heart function. Circulation 1999; 100:[suppl II], 247–256.
  11. Fukuda K. Development of regenerative cardiomyocytes from mesenchymal stem cells for cardiovascular tissue engineering. Artif Organs 2001; 25:187–193.[CrossRef][Medline]
  12. Xu W, Zhang X, Qian H, Zhu W, Sun X, Hu J, Zhou H, Chen Y. Mesenchymal stem cells from adult human bone marrow differentiate into a cardiomyocyte phenotype in vitro. Exp Biol Med 2004; 229:623–631.[Abstract/Free Full Text]
  13. Seshi B, Kumar S, King D. Multilineage gene expression in human bone marrow stromal cells as evidenced by single-cell microarray analysis. Blood Cells, Molecules and Diseases 2003; 33:268–285.
  14. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du J, Lisberg A, Low WC, Largaespada DA, Verfaille CM. Pluripotency of mesenchymal stem cells derived from adult bone marrow. Nature 2002; 418:41–49.[CrossRef][Medline]
  15. Ye NS, Zhang RL, Zhao YF, Feng X, Wang YM, Luo GA. Effect of 5-azacytidine on the protein expression of porcine bone marrow mesenchymal stem cells in vitro. Geno Prot Bioinfo 2006; 4:18–25.[CrossRef]



This article has been cited by other articles:


Home page
ICVTSHome page
Y. Zhang, Y. Chu, W. Shen, and Z. Dou
Effect of 5-azacytidine induction duration on differentiation of human first-trimester fetal mesenchymal stem cells towards cardiomyocyte-like cells
Interactive CardioVascular and Thoracic Surgery, December 1, 2009; 9(6): 943 - 946.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antonitsis, P.
Right arrow Articles by Papakonstantinou, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antonitsis, P.
Right arrow Articles by Papakonstantinou, C.
Related Collections
Right arrow Cardiac - other
Right arrow Molecular biology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ANN THORAC SURG ASIAN CARDIOVASC THORAC ANN EUR J CARDIOTHORAC SURG
J THORAC CARDIOVASC SURG ICVTS ALL CTSNet JOURNALS