| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
© 2003 European Association of Cardio-Thoracic Surgery
A model of neointima formation in the atherosclerotic carotid artery of mice
a Crafoord Laboratory of Experiment Surgery, Karolinska Hospital, 17176 Stockholm, Sweden
* Corresponding author. Tel.: +46-8-517-74846; fax: +46-8-517-73557 Received September 19, 2002; received in revised form January 29, 2003; accepted February 3, 2003
To establish a simple, reproducible model of neointima formation in mice with atherosclerotic vessels. Apolipoprotein E/low density lipoprotein receptor double knockout mice were fed an atherogenic diet. Carotid artery injury was induced by separate ligation of the external and internal carotid artery immediately distal to the bifurcation. Mice with normal vessels were used for comparison. Monocytes and macrophages were detected with immunohistochemistry using CD68 antibodies. The transcription factor nuclear factor kappa B was also detected by immunohistochemistry. Expression of tumor necrosis factor-  (TNF-) and interleukin-1ß (IL-1ß) was evaluated by real time polymerase chain reaction. Neointima and media areas were digitally measured and analyzed. Four weeks later carotid artery ligation had induced neointima formation proximal to the ligation site, apparent as a smooth muscle cell alpha-actin positive layer intimal to the lamina elastica interna. The shape and size of the lesions were reproducible. Nuclear localization of nuclear factor kappa B was found, and the expression of TNF- and IL-1ß increased after injury. CD68 positive cells were detected in the lumen, in the media and in the neointima. We have established in atherosclerotic mice a reproducible model of arterial injury with inflammation and neointima formation.
Key Words: Neointimal formation; Arterial injury; Apolipoprotein E; Inflammation; Nuclear factor kappa B
Due to neointimal hyperplasia restenosis occurs after percutaneous transluminal coronary angioplasty in 20–50% of patients after 3–6 months [1]. Although this may be reduced with stent placement, effective prevention of neointimal hyperplasia remains unresolved [2]. Neointimal hyperplasia is extensively studied, but clinical trials based on successful results from animal studies have failed to reduce human restenosis [2], possibly because the animals have healthy vessels [3]. The arterial wall responds to injury with an inflammatory reaction, smooth muscle cell phenotypic modulation, proliferation and migration to the intima layer [4]. Transcription factor nuclear factor kappa B (NF-  B) and some genes regulated by NF-B, such as tumor necrosis factor alpha (TNF-) and interleukin 1 beta (IL-1ß), may be pivotal for neointima formation [5].
The apolipoprotein E and low-density lipoprotein receptor double knockout (ApoE/LDLr KO) mouse quickly develops hyperlipidemia and advanced fibrofatty atherosclerotic lesions localized at bifurcation sites as in humans [6]. Several models of arterial injury have been established for mice, such as endothelial denudation using wire, external cuff placement, external plaque injury and electrical injury [7]. We wanted to establish a simple and reproducible model of injury in an atherosclerotic artery by separate ligation of the external and internal carotid arteries immediately distal to the carotid bifurcation, to avoid placing a ligature at the site of an atherosclerotic plaques in the bifurcation. In addition we studied the presence of inflammation in this model, evaluating NF-
2.1. Mouse handling Male ApoE/LDLr KO mice on C57BL/6 background were purchased from Bomholtg  rd (Bomholt, Denmark) ( ) and were fed an atherogenic diet containing 21% fat and 0.15% cholesterol (R683, AnalyCen, Linköping, Sweden) for 12 weeks prior to the studies and throughout the experiments. Two months old male C57BL/6 mice ( ) purchased from B&K Universal AB (Sollentuna, Sweden) were fed on chow and employed as controls. Animals were treated according to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health after approval from the Regional Ethics Committee for Animal Research. Under general anesthesia by intraperitoneal injection of 1 mg/kg fentanyl and 50 mg/kg fluanisone (Hypnorm®, Janssen Pharmaceutica, Belgium) plus 25 mg/kg midazolam (Dormicum®, Hoffman-La Roche, Switzerland) the right carotid artery was exposed. By using an operation microscope both the external and internal carotid artery were separately ligated close to the bifurcation with 8/0 Surgilene®. The left carotid artery was shamoperated. After 1, 4, 7, 14 and 28 days animals were reanesthesized and the ligated carotid artery and the shamoperated control artery were harvested. In each group six mice were used for lesion size measurements after 4 weeks, and at the other time points two mice were used for immunohistochemistry, and additionally two ApoE/LDLr KO mice were sampled for real time polymerase chain reaction (PCR) analysis. 2.2. Immunohistochemistry Frozen vessels were serially sectioned (7 µm), air-dried and mounted on superfrost glass. Sections were incubated with a rabbit polyclonal anti-NF-Bp65 antibody diluted 1:400 or a goat polyclonal anti-NF-Bp50 antibody diluted 1:400 (both Santa Cruz Biotechnology, Santa Cruz, CA, USA), or a mouse monoclonal anti-proliferating cell nuclear antigen (PCNA) antibody diluted 1:100 (Dako, Carpintiera, CA, USA). Monocytes and macrophages were detected by incubation with a rat anti mouse CD68 antibody (Serotec, Raleigh, NC, USA). After washing, species-specific secondary antibodies were employed, followed by incubation with an avidin-biotin peroxidase complex (Vector Laboratories, Burlington, CA, USA), and counterstained with hematoxyllin. Smooth muscle cells were identified with anti-smooth muscle -actin (Sigma-Aldrich, St. Louis, MO, USA) diluted 1:50 with 1% BSA, and visualized with First Red Kit (Vector Laboratories) diluted in Tris–HCl solution. For lipid deposition detection sections were stained with Oil red O (Sigma-Aldrich) and the nuclei counter stained with hematoxylin. 2.3. Total RNA extraction and cDNA synthesis Total RNA was extracted from the carotid arteries using an UltraspecTM reagent (Nordic BioSite AB) with an additional phenol/chloroform extraction step. All samples were treated with RNase free DNase I (Qiagen, Valencia, CA, USA). The RNA was then reversibly transcribed to cDNA using hexanucleotides and Superscript II reverse transcriptase (Invitrogen Inc, Carlsbad, CA, USA).2.4. Real time PCR Three µl cDNA was amplified in a volume of 25 µl, containing 1x TaqManTM Buffer, 5 mM MgCl2, 200 µM dNTP, 200 µM primer, 0.01 U Amp-EraseTM Uracil N-Glycosylase, 0.05 U Ampli Taq GoldTM (PE Applied Biosystems, Foster City, CA, USA) and 0.1 pM probe. All the primers and probes were designed using the computer program Primer Express (Perkin Elmer/Applied Biosystems, Foster City, CA). For TNF-, the primer was (all sequences 5'-3') FW GACCCTCACACTCAGATCATCCTTCT, RV ACGCTGGCTCAGCCACTC with the probe TAGCCC ACGTCGTAGCAAACCACCAA. The IL-ß primer was FW GAAAGACGGCACACCCACC, RV AAACCGCTTTTCCATCTTCTTCT with the probe TGCAGCTGGAGAGTGTGGATC, while for ß-actin FW AGAGGGAAATCGTGCGTGAC, RV CAATAGTGATGACCTGGCCGT and probe CACTGCCGCATCCTCTTCCTCCC was used. Each PCR reaction was performed in duplicates (2 min at 50°C, 10 min at 95°C, 0.15 min at 95°C and 1 min at 60°C with a total of 40 cycles) with ABI PrismTM7700 Sequence Detector (PE Applied Biosystems). Levels of TNF- and IL-1ß transcripts were expressed as the ratio to ß-actin in the exponential phase. 2.5. Evaluation of lesion size Neointima and media areas were digitally measured and analyzed (Leica Qwin®). Proximal to the ligatures neointima completely obstructed the lumen. The last section with full lumen obstruction was defined as the lesions starting point, and the size of neointima and media was measured 210 and 280 µm downward from this. The average value of these two measurements was employed for statistical analysis.2.6. Statistical analysis In figures individual data are presented, in text as mean values and standard deviation. Student's t-test was used to evaluate differences between groups.
3.1. Arterial morphology and lesion size Before ligation, eccentric atherosclerotic plaques could be observed in the carotid artery bifurcation in almost all ApoE/LDLr KO mice (Fig. 1). Four weeks after ligation all vessels developed neointima, which consisted predominantly of -actin positive smooth muscle cells in C57BL/6 mice (Fig. 1). ApoE/LDLr KO animals had a lipid-rich neointima, and luminal to this was an -actin positive smooth muscle cell layer (Fig. 1). There were no lipids in the arterial wall of C57BL/6 mice (Fig. 1). Lesion sizes in the ligated vessels were 55 748±16 286 µm2 in C57BL/6 controls and 96 301±27 181 µm2 in ApoE/LDLr KO animals ( ). Individual data for intima and media are shown in Fig. 2.
3.2. Inflammation In ApoE/LDLr KO mice ligated arteries, monocytes and macrophages were detected as CD68 positive cells in the media as well as in the lumen 4 days after ligation (Fig. 3). In same arteries CD68-positive cells were detected in the neointima after 4 weeks (Fig. 3). In ApoE/LDLr KO mice shamoperated control arteries, CD68 positive cells were only detected in atherosclerotic plaques (data not shown).
In C57BL/6 control mice immunostaining for the NF B subunits p65 and p50 showed nuclear localization detected 7 days and 4 weeks after ligation (Fig. 3).
ApoE/LDLr KO mice arteries were collected serially after ligation to study gene expression of TNF-
Cells positive for PCNA were seen in the media as well as in the lumen 7 days after ligation, and in the neointima layer also after 14 and 28 days after ligation in ApoE/LDLr KO as well as in C57BL/6 mice (Fig. 3).
ApoE/LDLr double knockout mice quickly develop atherosclerotic lesions in the bifurcation sites of the vascular tree, with a plaque composition similar to humans [6]. The ApoE/LDLr double knock out mice were chosen because the LDLrec single knock out only develops fatty streaks and not advanced fibrofatty lesions, while the ApoE single knock out takes much longer time to develop lesions [6] and thus become more expensive. When the experiments started, lipid rich plaques could be seen through the operation microscope in the carotid arteries of almost all atherosclerosis-prone animals. The injury of the vessel wall caused by balloon dilatation is not easy to mimic in murine arteries due to the small caliber. This problem is possible to circumvent by using external injury models, but the disadvantage is that the adventitia and media are mostly injured, while there is no direct damage to endothelium. However, ligation of mouse common carotid arteries damages all layers of the vessel wall, including the endothelium, causing neointima formation [8]. Our modification to previous publications was separate ligation of the external and internal branches to avoid placing a ligature at the site of an atherosclerotic plaque in ApoE/LDLr KO mice. ApoE/LDLr KO mice tended to develop larger neointimal lesions after ligation than C57BL/6 controls. Statistically there was not a true difference, but we do believe this is caused by a type II statistical error. However, the purpose of the present study was to establish the model in ApoE/LDLr KO mice, not to study the difference between the two murine genotypes. Our findings are in agreement with those using ApoE KO mice [1], where monocytes recruited from the circulation contribute to rapidly forming a foam cell rich neointima [9]. After ligation we found an increase of CD68 positive cells in the lumen, and later also in the arterial wall, suggesting recruitment of monocytes from the circulation. PCNA positive cells were found at the same locations as well as in the media, supporting the possibility that cells from both the circulation and the medial layer contributed to neointima formation.
In response to vascular injury an inflammatory reaction develops, with increased expression of proinflammatory cytokines and leukocyte adhesion molecules promoting recruitment of inflammatory cells [7,10]. Monocytes and macrophages in turn produce cytokines and growth factors, which may activate transcription factors and amplify the cascade reaction of inflammation [4]. NF In conclusion, we have established a reproducible model of arterial injury to study neointima formation in the atherosclerotic vessels of ApoE/LDLr KO mice. An inflammatory reaction developed in the vessel wall in response to injury.
Conference discussion Dr G. Lutter (Freiburg, Germany): Very interesting study and a good and reproducible model. There is one question not answered by now. What kind of therapeutic options do you see for your mice model? What will be your additional studies showing that your model is interesting to suppress the atherogenic effect you have shown us?
Dr Ruusalepp: In our laboratory we have studied role of NF- Dr C. Yankah (Berlin, Germany): I miss a clinical setting such as discontinuing the atherogenic nutrition at a certain time in a group and looking for reversibility of the atherosclerotic lesion? Dr Ruusalepp: No, the diet was just given to speed up the process of atherosclerotic plaque development. Dr K. Kallenbach (Hannover, Germany): I have a problem understanding your model. The injury you said is by ligation of the carotid arteries, correct? Dr Ruusalepp: Yes. Dr Kallenbach: I just wonder how reproducible is your model? How often do you see thrombosis into the common carotid artery? Because this is a very small vessel. And the plan for the future, is this just a tool to study biomolecular mechanisms, or do you plan on performing any surgical experiments on that? Dr Ruusalepp: We choose ligation because it's easy to carry on and it damages all layers of muscle wall. And in all animals we can see neointima formation after 4 weeks from injury. Dr Kallenbach: Why don't you see any thrombus formation in these small results? Did you not report of that, or you don't see that? Dr Ruusalepp: We haven't seen thrombosis in all vessels. There have been in some vessels, but we haven't given extra attention to this.
The technical assistance of Theres Jägerbrink and Qin Xu is gratefully acknowledged. This study was supported by the Swedish Medical Research Council (11 235 and 12 665), the Swedish Heart-Lung Foundation, and the King Gustaf V and Queen Victoria Foundation. AR was supported by a grant from the Eastern Europe Committee of the European Association for Cardio-thoracic Surgery.
Presented at the 16th Annual Meeting of the European Association for Cardio-thoracic Surgery, Monte Carlo, Monaco, September 22–25, 2002. doi:10.1016/S1569-9293(03)00042-2
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ANN THORAC SURG | ASIAN CARDIOVASC THORAC ANN | EUR J CARDIOTHORAC SURG |
| J THORAC CARDIOVASC SURG | ICVTS | ALL CTSNet JOURNALS |
Top
Abstract
1. Introduction
) were 
for the TNF-
for the IL-1ß. 